نوع مقاله : علمی پژوهشی - تغذیه نشخوارکنندگان
عنوان مقاله English
نویسندگان English
Introduction The main protein degradation product in ruminant is urea. The urea synthesized in liver and lost to the environment via urine and feces. However, there is mechanism in ruminants to recycling 40 to 80% of hepatic urea-N output to the gastrointestinal track (GIT). During the process of urea nitrogen salvaging (UNS), urea entry into the ruminant gastrointestinal tract via facilitative urea transporters. The passage of urea across cell membranes is facilitated by such transporters then the urea descends a concentration gradient and derived from two separate genes: SLC14A1 (UT-B) and SLC14A2 (UT-A). There is a chance for controlling of urea-N recycling to the GIT, via manipulating the dietary factors such as level and type of dietary crude protein that affect urea transporters-B expression. However changes in urea transporter expression in the rumen tissue of ruminants in response to dietary changes have not fully understood. Hence our hypothesis was that changes in the type of dietary protein sources and the level of dietary crude protein, are important because they determine how much N is directed toward ruminal NH3-N (25). This study aimed to show how concurrent alters in dietary protein sources and crude protein change nitrogen efficiency and ruminal UT-B expression in Baluchi male lambs.
Materials and Methods Four Baluchi male lambs (30 ± 2 kg BW) were used in a 4 × 4 Latin square design with 28-d periods (adaptation: 21 d and sampling: 7 d) and a 2 × 2 factorial arrangement of dietary treatments. Lambs had free access to clean water over the experimental period. The dietary factors studied were: 1) canola meal vs. canola meal with fish meal as the principal source of protein; and 2) dietary levels of crude protein of 16 vs. 18%. Treatments were offered to the animals twice daily for ad libitum intake (09:00 and 16:00 h). The DM, OM, and N contents were determined according to the AOAC. Volatile fatty acids were separated and quantified by gas chromatography. Ruminal NH3-N was determined using distillation method. Total N in pooled urine was determined using the macro-Kjeldahl procedure. For UT-B gene expression analysis, total RNA was extracted via High Pure RNA Isolation Kit, followed by digestion with RNasefree DNase. About, 1 µg of RNA was used to generate first-strand cDNA using cDNA Synthesis Kits. Gene transcript abundance was quantified using real-time quantitative PCR using SYBR Green fluorescence detection. The primers used for urea transporter-B (UT-B) and ovine glyceraldehyde 3-phosphate dehydrogenase (ovine GAPDH; NCBI Accession No. BC102589) were previously reported. Ovine GAPDH was used as an internal reference to normalize UT-B mRNA expression. Briefly, the PCR primers were UT-B (forward, 5′/ggacctgcctgtcttcactc/3′; reverse, 5′/gatcaaggtgcttgggaaaa/3′) and ovine GAPDH (forward, 5′/gattgtcagcaatgcctcct/3′; reverse, 5′/ggtcataagtccctccacga/3′) with amplicon size of 97 and 94 bp, respectively. Amplification conditions for ovine GAPDH and UT-B included a predwell for 3 min at 95 °C and 35 cycles of denaturing for 30 s at 95 °C and annealing for 30 s at 58 °C. The real-time qPCR reaction mixture used for each gene consisted of 12.5 μL of Maxima SYBR Green qPCR Master Mixes, 0.5 μL of each primer (25 μM), and 1.0 μL of template cDNA, made up to 25 μL. The amplification efficiency was 100.1%.
Result and Disscusion Lambs fed CM have greater nutrients intake, significantly. Crude protein level had no significant effect on nutrients intake except CP intake. Nutrients digestibility was not affected by treatments, CP content and dietary protein sources. Ruminal pH, VFA concentration and acetate to propionate ratio were not influenced by the experimental diets and dietary protein sources. Significant differences were observed for NH3-N and BUN concentration in lambs fed treatments contain 18% CP compared to the lambs fed diets contain 16% CP. Both of CP content and dietary protein sources had significant effect on N intake and urinary N excretion. Nitrogen intake and urinary N excretion increased as dietary CP level increased. Lambs fed CM have greater N intake and urinary N excretion, significantly. Fecal N excretion was not affected by treatments, CP content and dietary protein sources. Lambs received CM diets had higher apparent N balance. Expression of urea transporter-B mRNA (expressed as copies/copy of ovine GAPDH) was not affected by treatments. Also, dietary CP content and dietary protein sources could not impact on the expression of UT-B mRNA.
Conclusion Our finding suggest in studing of manipulating the expression of UT-B mRNA, both dietary factors such as dietary crude protein level and type of protein sources and ruminal factors shch as intra and para cellular pH should be considered.
کلیدواژهها English