پژوهشهای علوم دامی ایران

پژوهشهای علوم دامی ایران

اثر منابع مورد استفاده در پروتئین خوراک بر بازده نیتروژن و بیان ژن ناقل اوره (نوع ب) در بره‌های نر بلوچی تغذیه شده با سطوح مختلف پروتئین ‌خام

نوع مقاله : علمی پژوهشی - تغذیه نشخوارکنندگان

نویسندگان
1 استادیار گروه علوم‌دامی، مجتمع آموزش‌ عالی تربت‌جام، تربت‌جام، ایران
2 گروه علوم دامی، دانشکده کشاورزی،دانشگاه فردوسی مشهد، مشهد، ایران
3 گروه علوم دامی، دانشکده کشاورزی، دانشگاه فردوسی مشهد، مشهد، ایران
چکیده
به منظور بررسی تأثیر استفاده هم‌زمان منابع و مقادیر متنوع پروتئین ‌خام خوراک بر کنترل نیتروژن اوره‌ای بازگردانده شده به شکمبه و تنظیم بیان ژن ناقل اوره از چهار رأس بره نر بلوچی (2±30 کیلوگرم) دارای فیستولا در قالب طرح مربع لاتین 4×4 استفاده شد. تیمارهای آزمایشی از ترکیب دو منبع پروتئینی (کنجاله ‌کلزا و پودر ماهی) و دو مقدار پروتئین‌ خام (16 و 18 درصد) تشکیل شد. مقدار ماده‌ خشک مصرفی در بره‌های تغذیه شده با کنجاله ‌کلزا در مقایسه با بره‌های تغذیه شده با مخلوط کنجاله ‌کلزا و پودر ماهی به ‌صورت معنی‌داری بیشتر بود. تیمارها تأثیر معنی‌داری بر قابلیت هضم ماده خشک نداشتند. pH مایع شکمبه، غلظت اسیدهای چرب فرار و نسبت استات به پروپیونات، تحت تأثیر تیمارهای آزمایشی قرار نگرفتند. با افزایش مقدار پروتئین‌خام خوراک، غلظت آمونیاک شکمبه، نیتروژن اوره‌ای خون، مقدار نیتروژن دریافتی و مقدار نیتروژن ادرار به طور معنی‌داری افزایش یافت. مقدار نیتروژن مدفوع تحت تأثیر تیمارهای آزمایشی قرار نگرفت. توازن ظاهری نیتروژن در بره‌های تغذیه شده با کنجاله‌ کلزا در مقایسه با بره‌های تغذیه شده با مخلوط کنجاله‌ کلزا و پودر ماهی به صورت معنی‌داری بیشتر بود. بیان ژن ناقل اوره تحت تأثیر تیمارهای آزمایشی قرار نگرفت. این نتایج نشان می‌دهد که تغییر در مقدار پروتئین‌خام خوراک و نوع منبع پروتئینی به تنهایی نمی‌‌تواند بر بیان ژن ناقل اوره تأثیر گذار باشد. به نظر می‌‌رسد یکسری عوامل دیگر نیز همچون pH مایع شکمبه و pH درون سلولی در دیواره شکمبه بر بیان ژن ناقل اوره تأثیر گذار باشند.
کلیدواژه‌ها

عنوان مقاله English

Effect of Dietary Protein Sources On UT-B Expression and Nitrogen Efficiency in Baluchi Male Lambs Fed Low or High Crude Protein Diets

نویسندگان English

Elias Ibrahimi Khoram Abadi 1
Mohsen Danesh Mesgaran 2
Abdolmansour Tahmasbi 2
Abbas Ali Naserian 2
Seyed Alireza Vakili 3
1 Assistant Professor, Department of Animal Sciences, Faculty of Agriculture and Animal Science, University of Torbat-e Jam, Torbat-e Jam, Iran.
2 Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad,Mashhad, Iran
3 Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran
چکیده English

Introduction The main protein degradation product in ruminant is urea. The urea synthesized in liver and lost to the environment via urine and feces. However, there is mechanism in ruminants to recycling 40 to 80% of hepatic urea-N output to the gastrointestinal track (GIT). During the process of urea nitrogen salvaging (UNS), urea entry into the ruminant gastrointestinal tract via facilitative urea transporters. The passage of urea across cell membranes is facilitated by such transporters then the urea descends a concentration gradient and derived from two separate genes: SLC14A1 (UT-B) and SLC14A2 (UT-A). There is a chance for controlling of urea-N recycling to the GIT, via manipulating the dietary factors such as level and type of dietary crude protein that affect urea transporters-B expression. However changes in urea transporter expression in the rumen tissue of ruminants in response to dietary changes have not fully understood. Hence our hypothesis was that changes in the type of dietary protein sources and the level of dietary crude protein, are important because they determine how much N is directed toward ruminal NH3-N (25). This study aimed to show how concurrent alters in dietary protein sources and crude protein change nitrogen efficiency and ruminal UT-B expression in Baluchi male lambs.
Materials and Methods Four Baluchi male lambs (30 ± 2 kg BW) were used in a 4 × 4 Latin square design with 28-d periods (adaptation: 21 d and sampling: 7 d) and a 2 × 2 factorial arrangement of dietary treatments. Lambs had free access to clean water over the experimental period. The dietary factors studied were: 1) canola meal vs. canola meal with fish meal as the principal source of protein; and 2) dietary levels of crude protein of 16 vs. 18%. Treatments were offered to the animals twice daily for ad libitum intake (09:00 and 16:00 h). The DM, OM, and N contents were determined according to the AOAC. Volatile fatty acids were separated and quantified by gas chromatography. Ruminal NH3-N was determined using distillation method. Total N in pooled urine was determined using the macro-Kjeldahl procedure. For UT-B gene expression analysis, total RNA was extracted via High Pure RNA Isolation Kit, followed by digestion with RNasefree DNase. About, 1 µg of RNA was used to generate first-strand cDNA using cDNA Synthesis Kits. Gene transcript abundance was quantified using real-time quantitative PCR using SYBR Green fluorescence detection. The primers used for urea transporter-B (UT-B) and ovine glyceraldehyde 3-phosphate dehydrogenase (ovine GAPDH; NCBI Accession No. BC102589) were previously reported. Ovine GAPDH was used as an internal reference to normalize UT-B mRNA expression. Briefly, the PCR primers were UT-B (forward, 5′/ggacctgcctgtcttcactc/3′; reverse, 5′/gatcaaggtgcttgggaaaa/3′) and ovine GAPDH (forward, 5′/gattgtcagcaatgcctcct/3′; reverse, 5′/ggtcataagtccctccacga/3′) with amplicon size of 97 and 94 bp, respectively. Amplification conditions for ovine GAPDH and UT-B included a predwell for 3 min at 95 °C and 35 cycles of denaturing for 30 s at 95 °C and annealing for 30 s at 58 °C. The real-time qPCR reaction mixture used for each gene consisted of 12.5 μL of Maxima SYBR Green qPCR Master Mixes, 0.5 μL of each primer (25 μM), and 1.0 μL of template cDNA, made up to 25 μL. The amplification efficiency was 100.1%.
Result and Disscusion Lambs fed CM have greater nutrients intake, significantly. Crude protein level had no significant effect on nutrients intake except CP intake. Nutrients digestibility was not affected by treatments, CP content and dietary protein sources. Ruminal pH, VFA concentration and acetate to propionate ratio were not influenced by the experimental diets and dietary protein sources. Significant differences were observed for NH3-N and BUN concentration in lambs fed treatments contain 18% CP compared to the lambs fed diets contain 16% CP. Both of CP content and dietary protein sources had significant effect on N intake and urinary N excretion. Nitrogen intake and urinary N excretion increased as dietary CP level increased. Lambs fed CM have greater N intake and urinary N excretion, significantly. Fecal N excretion was not affected by treatments, CP content and dietary protein sources. Lambs received CM diets had higher apparent N balance. Expression of urea transporter-B mRNA (expressed as copies/copy of ovine GAPDH) was not affected by treatments. Also, dietary CP content and dietary protein sources could not impact on the expression of UT-B mRNA.
Conclusion Our finding suggest in studing of manipulating the expression of UT-B mRNA, both dietary factors such as dietary crude protein level and type of protein sources and ruminal factors shch as intra and para cellular pH should be considered.

کلیدواژه‌ها English

Canola
Fish meal
N balance
Protein
Urea transporter
1- AOAC International. 2012. Official Methods of Analysis, 19th ed. AOAC International, Gaithersburg, MD.
2- Abdoun, K., F. Stumpff., I. Rabbani, and H. Martens. 2010. Modulation of urea transport across sheep rumen epithelium in vitro by SCFA and CO2. American Journal of Physiology, 298: 190-202.
3- Archibeque, S. L., J. C. Burns, and G. B. Huntington. 2001. Urea flux in beef steers: Effects of forage species and nitrogen fertilization. Journal of Animal Science, 79: 1937-1943.
4- Bach, A., S. Calsamiglia, and M. D. Stern. 2005. Nitrogen metabolism in the rumen. Journal of Dairy Science, 88: 9-21.
5- Bandyk, C. A., R. C. Cochran., T. A. Wickersham., E. C. Titgemeyer., C. G. Farmer, and J. J. Higgins. 2001. Effect of ruminal vs. postruminal administration of degradable protein on utilization of low-quality forage by beef steers. Journal of Animal Science, 79: 225-231.
6- Bateman, H. G., J. H. Clark, and M. R. Murphy. 2005. Development of a system to predict feed protein flow to the small intestine of cattle. Journal of Dairy Science, 88: 282-295.
7- Beauchemin, K. A., W. Z. Yang., D. P. Morgavi., G. R. Ghorbani., W. Kautz, and J. A. Z. Leedle. 2003. Effects of bacterial direct-fed mcirobials and yeast on site and extent of digestion, blood chemistry, and subclinical ruminal acidosis in feedlot cattle. Journal of Animal Science, 81: 1628-1640.
8- Conway, W. J. 1950. Microdiffusion analysis and volumetric error, 2nd ed. Crosby lock wood and son, London, UK.
9- Carneiro, A., A. Esquivel., D. E. Hogue, and M. L. Thonney. 2006. Effect of fermentable fiber and protein source on feed intake and efficiency of growing lamb. Conference on Asia Agriculture and Animal Science, 13: 1-6.
10- Castillo, A. R., E. Kebreab., D. E. Beever., J. H. Barbi., J. D. Sutton., H. C. Kirby, and J. France. 2001. The effect of protein supplementation on nitrogen utilization in lactating dairy cows fed grass silage diets. Journal of Animal Science, 79: 247-253.
11- Cheng, K. J, and R. J. Wallace. 1979. The mechanism of passage of endogenous urea through the rumen wall and the role of ureolytic epithelial bacteria in the urea flow. British Journal of Nutrition, 42: 553-557.
12- Church, D. C. 1988. In The Ruminant Animal Digestive Physiology and Nutrition. Prentice Hall, Englewood Cliffs, New Jersey.
13- Cunningham, K. D., M. J. Cecava., T. R. Johnson, and P. A. Ludden. 1996. Influence of source and amount of dietary protein on milk yield by cows in early lactation. Journal of Dairy Science, 79: 620-630.
14- Davenport, G. M., J. A. Boling, and K. K. Schillo. 1990. Nitrogen metabolism and somatotropin secretion in beefheifers receiving abomasal arginine infusions. Journal of Animal Science, 68: 1683-1692
15- Gill, M, and D. E. Beever. 1982. The effect ofprotein supplementation on digestion and glucose metabolism in young cattle fed on silage. British Journal of Nutrition, 48: 37-47.
16- Gleghorn, J. F., N. A. Elam., M. L. Galyean., G. C. Duff., N. A. Cole, and J. D. Rivera. 2004. Effects of crude protein concentration and degradability on performance, carcass characteristics, and serum urea nitrogen concentrations in finishing beef steers. Journal of Animal Science, 82:2705-2717.
17- Hall, M. B, and G. B. Huntington. 2008. Nutrient synchrony: Sound in theory, elusive in practice. Journal of Animal Science, 82: 3237-3244.
18- Hristov, A. N, and J. P. Jouany. 2005. Factors affecting the efficiency of nitrogen utilization in the rumen. Pages 117-166 in: Nitrogen and Phosphorus Nutrition of Cattle: Reducing the Environmental Impact of Cattle Operations. E. Pfeffer, and A.V. Hristov, ed. CABI Publishing, Wallingford, UK.
19- Jørgensen, H., W. C. Sauer, and P. A. Thacker. 1984. Amino acid availabilities in soybean meal, sunflower meal, fish meal and meat and bone meal fed to growing pigs. Journal of Animal Science, 58: 926-934.
20- Kebreab, E., J. France., J. A. N. Mills., R. Allison., and J. Dijkstra. 2002. A dynamic model of N metabolism in the lactating dairy cow and an assessment of impact of N excretion on the environment. Journal of Animal Science, 80: 248-259.
21- Kennedy, P. M, and L. P. Milligan. 1980. The degradation and utilization of endogenous urea in the gastrointestinal tract of ruminants: A review. Canadian Journal of Animal Science, 60: 205-221.
22- Khalid, M. F., M. Sarwar., U. N. Mahr, and U. R. Zia. 2011. Response of growing lambs fed on different vegetable protein sources with or without probiotics. International Journal of Agriculture and Biology, 13: 332-338.
23- Kiran, D, and T. Mutsvangwa. 2010. Effects of partial defaunation on urea-nitrogen recycling, nitrogen metabolism, and microbial nitrogen supply in growing lambs fed low or high dietary crude protein concentrations. Journal of Animal Science, 88: 1034-1047.
24- Knowlton, K. F., J. H. Herbein., M. A. Meister-Weisbarth, and W. A. Wark. 2001. Nitrogen and phosphorus partitioning in lactating Holstein cows fed different sources of dietary protein and phosphorus. Journal of Dairy Science, 84: 1210-1217.
25- Lapierre, H, and G. E. Lobley. 2001. Nitrogen recycling in the ruminant: A review. Journal of Dairy Science, 84: 223-236.
26- Legleiter, L. R., A. M. Mueller, and M. S. Kerley 2005. Level of supplemental protein does not influence the ruminally undegradable protein value. Journal of Animal Science, 83: 863-870.
27- Marini, J. C., J. D. Klein., J. M. Sands, and M. E. Van Amburgh. 2004. Effect of nitrogen intake on nitrogen recycling and urea transporter abundance in lambs. Journal of Animal Science, 82: 1157-1164.
28- Marini, J. C, and M. E. Van Amburgh 2003. Nitrogen metabolism and recycling in Holstein heifers. Journal of Animal Science, 81: 545-552.
29- Merchen, N. R, and E. C. Titgemeyer. 1992. Manipulation of amino acid supply to the growing ruminant. Journal of Animal Science, 70: 3238-3247.
30- Nocek, J. E. 1997. Bovine acidosis: implications on laminitis. Journal of Dairy Science, 80: 1005-1028.
31- Ottenstein, D. M, and D. A. Bartley. 1971. Improved gas chromatography separation of free acids C2-C5 in dilute solution. Annual Chemistry, 43: 952-955.
32- Remond, D., F. Meschy, and R. Boivin. 1996. Metabolites, water and mineral exchanges cross the rumen wall: Mechanisms and regulation. Annual Zootechnology, 45: 97-119.
33- Reynal, S. M, and G. A. Broderick. 2005. Effect of dietary level of rumen-degraded protein on production and nitrogen metabolism in lactating dairy cows. Journal of Dairy Science, 88: 4045-4064.
34- Santos, F. A., J. E. Santos., C. B. Theurer, and J. T. Huber. 1988. Effects of rumen-undegradable protein on dairy cow performance: a 12-year literature review. Journal of Dairy Science, 81(12): 3182-213.
35- SAS Institute. 2004. SAS/STAT 9.1 User’s Guide. SAS Institute Inc., Cary, NC.
36- Shingfield, K. J., S. Jaakkola, and P. Huhtanen. 2001. Effects of level of nitrogen fertilizer application and various nitrogenous supplements on milk production and nitrogen utilization of dairy cows given grass silage-based diets. Animal Science, 73: 541-554.
37- Siddons, R. C., J. V. Nolan., D. E. Beever, and J. C. MacRae. 1985. Nitrogen digestion and metabolism in sheep consuming diets containing contrasting forms and levels of N. British Journal of Nutrition, 54: 175-187.
ارسال نظر در مورد این مقاله
نام را وارد کنید.
نشانی پست الکترونیکی را به درستی وارد کنید.
وابستگی سازمانی را به درستی وارد کنید.
توضیحات را وارد کنید (حداقل 50 حرف)
CAPTCHA Image
شناسه امنیتی را به درستی وارد کنید.
دوره 9، شماره 2 - شماره پیاپی 30
تابستان 1396
صفحه 146-157

  • تاریخ دریافت 06 مرداد 1393
  • تاریخ اولین انتشار 01 تیر 1396