Iranian Journal of Animal Science Research

Iranian Journal of Animal Science Research

Effect of BIEC2-808543 Near LCORL on Body Size of Iranian Arab horse

Document Type : Research Articles

Authors
Animal Science Research Department, Yazd Agricultural and Natural Resources Research and Education Center, AREEO, Yazd, Iran
Abstract
Introduction:
Body size is one of the main features for the classification of horses. Among these features, the length of the body is one of the aspects that considered essential for animal's nutrition and height at withers applies for intra-species separating. Genome Wide Association Studies have demonstrated LCORL gene code a transcription factor that those polymorphisms are associated with skeletal frame size and body length. Recently, BIEC2-808543 SNP located upstream of LCORL was identified as a genetic diagnostic marker associated with withers height and also the length of Cannon bone in Thoroughbred horses. BIEC2-808543 is This SNP effect on TFIID binding site in TATA box. The substitution of C to T allele causes changes affinity of TFIID to TATA box. because of this is the effect on indicating TFIID by a pro-motor nuclear element which is the first step in mRNA transcription and in result effects on other transcription factors of bone-like AP-1, activator protein-1 transcription factor complex, AP-1 is activated as one complex of mRNA and subsequently transcription get higher. On the other words, skeletal bones are expanded by three chondrocytes, osteoblasts and osteoclasts cells. The difference and performances of these cells are regulated by some special factors that are effective on gene expression.
Near the LCORL gene in chromosome 3, there is a QTL which is associated with height at withers, composition of legs, length of horse' s rump, head and jaw of the horse. The purpose of this research was studying of genotype and allele frequency of BIEC2-808543 and its relationship with body size in Iranian Arab horse.
Materials and methods:
A total of 152 (85 males and 67 females) Iranian Arab horses were used in this study. All horses were born between 1990–2015, and the mean of age was 7.3 years. All horse's data were registered at WAHO and was get from Yazd Arabic Horseshoe. The time of this research was 1396 and the information was gathered from horse breeding clubs in the city of Ashkezar. The city of Ashkezar is the center of Arabic horse breeding. Measurements included withers height (cm), chest circumference (cm), and leg length. Also, each horse was judged as view of foot, head and neck and score of 0-20 was registered. The referee of this research was experienced experts in the Iranian horses' club located in Yazd. Blood samples were collected from 141 animals and in the molecular genetic laboratory of Islamic Azad University of Ashkezar stored at −20°C. Genomic DNA was extracted by Gene All kit (Company Gene All, South Korea (according to the manufacturer’s protocol. We used Thermocycler for PCR and duplication fragments. The volume of the reaction was 25 μl including 14 μl master mix, 1 μl forward, 1 μl reverse, 9μl water. Genotyping for BIEC2-808543 was performed using by PCR-RFLP by Alu1 (Company Sina Clone) restriction enzyme. primer designing was applied primer 3 software and the Restriction Mapper software (Online site was used) for PCR was used to distinct the used restriction enzyme. Forward primer sequence has TGGAGTCAGTTGGGTTTAATG and Reverse primer sequence has GACCGGATAGCATAGAGAGAG. Genetic association analysis for withers height, chest circumference, leg length, and judgment scores were performed using SNPassoc package (R software). compare mean between race and show horse was performed using Non-parametric mann-whitneyU. Weir&Cocker ham'sFst was estimated by FSTAT software.
 
 
Results and discussion:
Results of Genotyping of BIEC2-808543 SNP showed that one of the horses with the name of Meraj Mofidian (father name: Zelzeleh) is CT. The others were TT genotype. In this study 99/2% of horses had the TT genotype. Results represent fixation of T allele of BIEC2-808543 SNP on this gene in Iranian Arab horses. There was no significant difference between scores in three aspects, hands, legs, head and neck of show and race horses. Also, Genotype frequency of BIEC2-80543 SNP of show and race horse was similar. Estimated FST between race and show horses was tiny amount (-0.005) and show no genetic difference of LCORL gene between two groups. Though there was no significant difference of withers height, and leg length and judgment scores between race and show groups.
Conclusion:
Allele T in BIEC2-808543 polymorphism in Iranian Arab horse stabilization and approves endurance of this breed. Race Iranian Arab horse have bigger Chest circumference because of racing in short distances.
Keywords

- Baron, E., M. Lopes, D. Mendonca, and A. da Câmara Machado. 2012. SNP identification and polymorphism analysis in exon 2 of the horse myostatin gene. Animal Genetics, 43(2), 229-232.
2- Bruce, A., A. Johnson, J. Lewis, M. Raff, K. Roberts, and P. Walter. 2002. Molecular Biology of the Cell, 4th edition. New York: Garland Science. ISBN-10: 0-8153-3218-1ISBN-10: 0-8153-4072-9.
3- Felt, V. 2016. Genetic analysis of conformation traits in Icelandic horses with a focus on head morphology and body length.
4- Frischknecht, M., V. Jagannathan, P. Platte, M. Neuditschko, H. Signer-Hasler, I. Bachmann, and C. Flury. 2015. A non-synonymous HMGA2 variant decreases height in Shetland ponies and other small horses. PloS one, 10(10), e0140749.
5- He, S., L. Zhang, W. Li, and M. Liu. 2015. BIEC2-808543 SNP in the LCORL gene is associated with body conformation in the Yili horse. Animal biotechnology. 26(4),289-291.6- Makvandi-Nejad, S., et al. 2012. Four Loci Explain 83% of Size Variation in the Horse. PLoS ONE, 7(7): p. e39929.
7- Metzger, J., et al. 2013. Expression levels of LCORL are associated with body size in horses. PLoS One, 8(2): p. e56497.
8- Okuda, Y., H. H. Moe, K. K. Moe, Y. Shimizu, K. Nishioka, T. Shimogiri, and T. Kunieda. (2017). Genotype distribution and allele frequencies of the genes associated with body composition and locomotion traits in Myanmar native horses. Animal Science Journal, 88(8), 1198-1203.
9- Petersen, J. L., J. R. Mickelson, A. K. Rendahl, S. J. Valberg, L. S. Andersson, J. Axelsson, and A. S. Borges. 2013. Genome-wide analysis reveals selection for important traits in domestic horse breeds.PLoS Genetics, 9(1), e1003211.
10- Signer-Hasler, H., et al. 2013. A genome-wide association study reveals loci influencing height and other conformation traits in horses. PLoS One, 7(5): p. e37282.
11- Staiger, E. A., M. Al Abri, K. M. Pflug, S. Kalla, D. Ainsworth, D. Miller, and S. A. Brooks. 2016. Skeletal variation in Tennessee Walking Horses maps to the LCORL/NCAPG gene region. Physiological Genomics, 48(5), 325-335.
12- Tetens, J., P. Widmann, C. Kühn, and G. Thaller. 2013. A genome‐wide association study indicatesLCORL/NCAPG as a candidate locus for withers height in German Warmblood horses. AnimalGenetics, 44(4), 467-471.
13- Tozaki, T., et al. 2016. Sequence variants of BIEC2-808543 near LCORL are associated with body composition in Thoroughbreds under training. Journal of Equine Science, 27(3): p. 107.
14- Weir, Bruce S., and C. Clark Cockerham. 1984. "Estimating F‐statistics for the analysis of population structure." Evolution, 38(6):1358-1370.
Send comment about this article
Enter Name.
Enter a valid email address.
Enter a vaid affiliation.
Enter comments (At leaset 10 words)
CAPTCHA Image
Enter Security Code Correctly.

  • Receive Date 02 February 2019
  • Revise Date 07 May 2019
  • Accept Date 25 June 2019
  • First Publish Date 20 March 2020