نوع مقاله : علمی پژوهشی- ژنتیک و اصلاح دام و طیور
نویسندگان
1 دانشگاه علم و هنر یزد
2 بخش تحقیقات علوم دامی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی یزد، سازمان تحقیقات ، آموزش و ترویج کشاورزی، یزد، ایران
3 گروه زیست شناسی، دکتری تخصصی ژنتیک، مرکز تحقیقات زیست فناوری پزشکی، واحد اشکذر، دانشگاه آزاد اسلامی ، اشکذر، یزد
چکیده
کلیدواژه‌ها
عنوان مقاله [English]
نویسندگان [English]
Introduction:
Body size is one of the main features for the classification of horses. Among these features, the length of the body is one of the aspects that considered essential for animal's nutrition and height at withers applies for intra-species separating. Genome Wide Association Studies have demonstrated LCORL gene code a transcription factor that those polymorphisms are associated with skeletal frame size and body length. Recently, BIEC2-808543 SNP located upstream of LCORL was identified as a genetic diagnostic marker associated with withers height and also the length of Cannon bone in Thoroughbred horses. BIEC2-808543 is This SNP effect on TFIID binding site in TATA box. The substitution of C to T allele causes changes affinity of TFIID to TATA box. because of this is the effect on indicating TFIID by a pro-motor nuclear element which is the first step in mRNA transcription and in result effects on other transcription factors of bone-like AP-1, activator protein-1 transcription factor complex, AP-1 is activated as one complex of mRNA and subsequently transcription get higher. On the other words, skeletal bones are expanded by three chondrocytes, osteoblasts and osteoclasts cells. The difference and performances of these cells are regulated by some special factors that are effective on gene expression.
Near the LCORL gene in chromosome 3, there is a QTL which is associated with height at withers, composition of legs, length of horse' s rump, head and jaw of the horse. The purpose of this research was studying of genotype and allele frequency of BIEC2-808543 and its relationship with body size in Iranian Arab horse.
Materials and methods:
A total of 152 (85 males and 67 females) Iranian Arab horses were used in this study. All horses were born between 1990–2015, and the mean of age was 7.3 years. All horse's data were registered at WAHO and was get from Yazd Arabic Horseshoe. The time of this research was 1396 and the information was gathered from horse breeding clubs in the city of Ashkezar. The city of Ashkezar is the center of Arabic horse breeding. Measurements included withers height (cm), chest circumference (cm), and leg length. Also, each horse was judged as view of foot, head and neck and score of 0-20 was registered. The referee of this research was experienced experts in the Iranian horses' club located in Yazd. Blood samples were collected from 141 animals and in the molecular genetic laboratory of Islamic Azad University of Ashkezar stored at −20°C. Genomic DNA was extracted by Gene All kit (Company Gene All, South Korea (according to the manufacturer’s protocol. We used Thermocycler for PCR and duplication fragments. The volume of the reaction was 25 μl including 14 μl master mix, 1 μl forward, 1 μl reverse, 9μl water. Genotyping for BIEC2-808543 was performed using by PCR-RFLP by Alu1 (Company Sina Clone) restriction enzyme. primer designing was applied primer 3 software and the Restriction Mapper software (Online site was used) for PCR was used to distinct the used restriction enzyme. Forward primer sequence has TGGAGTCAGTTGGGTTTAATG and Reverse primer sequence has GACCGGATAGCATAGAGAGAG. Genetic association analysis for withers height, chest circumference, leg length, and judgment scores were performed using SNPassoc package (R software). compare mean between race and show horse was performed using Non-parametric mann-whitneyU. Weir&Cocker ham'sFst was estimated by FSTAT software.
Results and discussion:
Results of Genotyping of BIEC2-808543 SNP showed that one of the horses with the name of Meraj Mofidian (father name: Zelzeleh) is CT. The others were TT genotype. In this study 99/2% of horses had the TT genotype. Results represent fixation of T allele of BIEC2-808543 SNP on this gene in Iranian Arab horses. There was no significant difference between scores in three aspects, hands, legs, head and neck of show and race horses. Also, Genotype frequency of BIEC2-80543 SNP of show and race horse was similar. Estimated FST between race and show horses was tiny amount (-0.005) and show no genetic difference of LCORL gene between two groups. Though there was no significant difference of withers height, and leg length and judgment scores between race and show groups.
Conclusion:
Allele T in BIEC2-808543 polymorphism in Iranian Arab horse stabilization and approves endurance of this breed. Race Iranian Arab horse have bigger Chest circumference because of racing in short distances.
کلیدواژه‌ها [English]
)
ارسال نظر در مورد این مقاله